Antithrombin deficiency caused by SERPINC1 gene mutation in white matter lesions: A case report.

RATIONALE: White matter lesions (WMLs) are structural changes in the brain that manifest as demyelination in the central nervous system pathologically. Vasogenic WMLs are the most prevalent type, primarily associated with advanced age and cerebrovascular risk factors. Conversely, immunogenic WMLs, typified by multiple sclerosis (MS), are more frequently observed in younger patients. It is crucial to distinguish between these 2 etiologies. Furthermore, in cases where multiple individuals exhibit WMLs within 1 family, genetic testing may offer a significant diagnostic perspective. PATIENT CONCERNS: A 25-year-old male presented to the Department of Neurology with recurrent headaches. He was healthy previously and the neurological examination was negative. Brain magnetic resonance imaging (MRI) showed widespread white matter hyperintensity lesions surrounding the ventricles and subcortical regions on T2-weighted and T2 fluid-attenuated inversion recovery images, mimicking immunogenic disease-MS. DIAGNOSES: The patient was diagnosed with a patent foramen ovale, which could explain his headache syndrome. Genetic testing unveiled a previously unidentified missense mutation in the SERPINC1 gene in the patient and his father. The specific abnormal laboratory finding was a reduction in antithrombin III activity, and the decrease may serve as the underlying cause for the presence of multiple intracranial WMLs observed in both the patient and his father. INTERVENTIONS: The patient received percutaneous patent foramen ovale closure surgery and took antiplatelet drug recommended by cardiologists and was followed up for 1 month and 6 months after operation. OUTCOMES: While the lesions on MRI remain unchanging during follow-up, the patient reported a significant relief in headaches compared to the initial presentation. LESSONS: This case introduces a novel perspective on the etiology of cerebral WMLs, suggesting that hereditary antithrombin deficiency (ATD) could contribute to altered blood composition and may serve as an underlying cause in certain individuals with asymptomatic WMLs.

Pulmonary thromboembolism associated with hereditary antithrombin III deficiency: A case report.

BACKGROUND: Thrombophilia is a coagulation disorder closely associated with venous thromboembolism. Hereditary antithrombin III (AT III) deficiency is a type of genetic thrombophilia. In China, genetic thrombophilia patients mainly suffer from deficiencies in AT III, protein S, and protein C. Multiple mutations in the serpin family C member 1 (SERPINC1) can affect AT III activity, resulting in thrombosis. CASE PRESENTATION: This case presented a 17-year-old adolescent female who developed lower extremity venous thrombosis and subsequently pulmonary embolism (PE) following a right leg injury. A missense mutation in gene SERPINC1 of c.331 T > C, p.S111P was detected on the patient, resulting in a decreased AT III activity and an elevated risk of thrombosis. The patient received anticoagulation treatment for approximately 5 months. During follow-up, the blood clot gradually dissolved, and there have been no recurrent thrombotic events reported thus far. DISCUSSION: Hereditary AT deficiency can be classified into two types based on the plasma levels of the enzymatic activity and antigen. Type I is a quantitative defect, while Type II is a qualitive defect. Until 2021, 486 SERPINC1 gene mutations have been registered, more than 18% of which are point mutations. The SERPINC1 mutation c.331 T > C in was firstly reported in 2017, which was classified into type I AT III deficiency. CONCLUSION: Hereditary thrombophilia is a coagulation disorder with a high omission diagnostic rate. Minor mutations in the SERPINC1 gene can also lead to hereditary AT III deficiency, which in turn can cause PE. We emphasized the importance of etiological screening for hereditary thrombophilia in venous thromboembolism patients without obvious high-risk factors. Long-term anticoagulation treatment and avoidance of potential thrombosis risk factors are critical for such patients.

Hereditary Antithrombin Deficiency Presenting with Cerebral Venous Thrombosis in Three Members of a Family.

Hereditary antithrombin (AT) deficiency is a rare thrombophilia associated with cerebral vein thrombosis (CVT). We report a case study of hereditary AT deficiency causing CVT in three members of a family. A 29-year-old female presented with features of CVT. Her mother and a sister had CVT in the past and investigation for hereditary thrombophilia revealed low blood AT activity in all of them. The index patient (proband) was positive for the SERPINC1 gene mutation confirming the diagnosis of hereditary AT deficiency. She recovered well with anticoagulation and was advised to continue it lifelong. Diagnosing hereditary thrombophilia like AT deficiency is important in planning anticoagulation and proper counseling of asymptomatic family members regarding prophylaxis for venous thromboembolism (VTE) in high-risk situations.

Peripartum management of deep venous thrombosis in the context of antithrombin deficiency and May-Thurner syndrome.

Literature regarding the management of thrombus refractory to first-line treatment in the setting of pregnancy is limited, and management is made even more complicated in the context of thrombophilia. This case reviews the management of a patient with antithrombin deficiency who developed a massive thrombus during pregnancy, which was complicated by May-Thurner syndrome, lack of improvement with heparin, and preterm labor. The patient received multidisciplinary care throughout the pregnancy. At 35 weeks, anticoagulation was paused as she underwent induction of labor and delivery followed by postpartum placement of inferior vena cava filter and restarting heparin. Successful management of our pregnant patient with thrombus refractory to heparin hinged on individualized treatment for medical optimization with anticoagulation and antithrombin concentrate prior to labor followed by immediate postpartum placement of inferior vena cava filter.

Fatal Cerebral Venous Thrombosis in a Pregnant Woman with Inherited Antithrombin Deficiency after BNT162b2 mRNA COVID-19 Vaccination.

Antithrombin deficiency is a high-risk factor for venous thromboembolism during pregnancy, whereas cerebral venous thrombosis is rare. Cerebral venous thrombosis related to coronavirus disease 2019 (COVID-19) vaccines has been reported; however, there are a few reports of cerebral venous thrombosis after a messenger RNA (mRNA) vaccination. A 25-year-old female in her sixth week of pregnancy presented with headache 24 days after BNT162b2 mRNA COVID-19 vaccination. The following day, she presented with altered sensorium and was diagnosed with severe cerebral venous thrombosis. She demonstrated heparin resistance and was found to have an inherited antithrombin deficiency. A heterozygous missense variant in SERPINC1 (c.379T>C, p.Cys127Arg, 'AT Morioka') was detected by DNA analysis. Despite intensive care with unfractionated heparin, antithrombin concentrate, and repeated endovascular treatments, she died on the sixth day of hospitalization. Cerebral venous thrombosis in pregnant women with an antithrombin deficiency can follow a rapid and fatal course. Treatment with unfractionated heparin and antithrombin concentrate may be ineffective in severe cerebral venous thrombosis cases with antithrombin deficiency. Early recognition of antithrombin deficiency and an immediate switch to other anticoagulants may be required. Although the association between cerebral venous thrombosis and the vaccine is uncertain, COVID-19 vaccinations may require careful evaluation for patients with prothrombic factors.

Inherited antithrombin deficiency caused by a mutation in the SERPINC1 gene: A case report.

RATIONALE: Inherited antithrombin deficiency (ATD) is a major cause of thrombotic deficiency. Genetic testing is of great value in the diagnosis of hereditary thrombophilia. Herein, we report a case of inherited ATD admitted to our hospital. We include the results of genealogy and discuss the significance of genetic testing in high-risk groups of hereditary thrombophilia. PATIENT CONCERNS: A 16-year-old male patient presented with chest tightness, shortness of breath, wheezing, and intermittent fever (up to 39 °C) after strenuous exercise for 2 weeks. He also had a cough with white sputum with a small amount of bright red blood in the sputum and occasional back pain. DIAGNOSES: The blood tests showed that the patient's antithrombin III concentration and activity were both significantly reduced to 41% and 43.2%, respectively. Enhanced chest computed tomography scans showed pulmonary infarction in the lower lobe of the right lung with multiple embolisms in the bilateral pulmonary arteries and branches. Lower vein angiography revealed a contrast-filling defect of the inferior vena cava and left common iliac vein. Thrombosis was considered as a differential diagnosis. His father and his uncle also had a history of thrombosis. The patient was diagnosed with inherited ATD. Further, peripheral venous blood samples of the family members were collected for whole-exome gene sequencing, and Sanger sequencing was used to verify the gene mutation site in the family. The patient and his father had a SERPINC1 gene duplication mutation: c.1315_1345dupCCTTTCCTGGTTTTTAAGAGAAGTTCCTC (NM000488.4). INTERVENTIONS: An inferior vena cava filter was inserted to avoid thrombus shedding from the lower limbs. Urokinase was injected intermittently through the femoral vein cannula for thrombolysis. Heparin combined with warfarin anticoagulant therapy was sequentially administered. After reaching the international normalized ratio, heparin was discontinued, and oral warfarin anticoagulant therapy was continued. After discharge, the patient was switched to rivaroxaban as oral anticoagulation therapy. OUTCOMES: The patient's clinical symptoms disappeared. reexamination showed that the thrombotic load was less than before, and the inferior vena cava filter was then removed. LESSONS: By this report we highlight that gene detection and phenotypic analysis are important means to study inherited ATD.

Management of Antithrombin Deficiency in Pregnancy.

Antithrombin (AT) deficiency is a high-risk thrombophilia and a rare condition. The risk of venous thromboembolism (VTE) is increased in AT-deficient women during pregnancy and the postpartum period and is especially high in women with a prior history of VTE. A thorough assessment of VTE risk is recommended in pregnant AT-deficient women, comprising the degree and type of AT deficiency, genetic mutations, personal and family history, and additional preexisting or pregnancy-specific risk factors. Due to a lack of adequate study data, there is limited guidance on the management of AT deficiency in pregnancy, including the need for prophylactic anticoagulation, the appropriate dose of low-molecular-weight heparin (LMWH), and the role of AT substitution. LMWH is the medication of choice for the pharmacological prophylaxis and treatment of VTE in pregnancy. Patients with a history of VTE should receive full-dose LMWH during pregnancy and the postpartum period. AT concentrates are a treatment option when anticoagulation is withheld in potentially high-risk events such as childbirth, bleeding, or surgery and in cases of acute VTE despite the use of therapeutic dose anticoagulation. Women with AT deficiency should be counseled at specialized centers for coagulation disorders or vascular medicine, and close cooperation between obstetricians and anesthesiologists is warranted before delivery and during the peripartum period.

Prevention of venous thromboembolism in pregnant women with congenital antithrombin deficiency: a retrospective study of a candidate protocol.

BACKGROUND: The best thromboprophylaxis for pregnant women with congenital antithrombin deficiency (CAD) is controversial. OBJECTIVE: To clarify the effectiveness of a protocol for venous thromboembolism (VTE) prevention in pregnant women with CAD. METHODS: Women at high risk of VTE were administered antithrombin concentrate and heparin after conception, whereas those at low risk of VTE were administered heparin alone until delivery. All women received antithrombin concentrate at delivery except for one who was diagnosed with CAD. RESULTS: Ten women had CAD, including one in the high-risk group and nine in the low-risk group. No women had VTE at delivery as per the protocol for VTE prevention. Almost all women had increased antithrombin activity before delivery followed by maintenance at ≥ 70% due to antithrombin concentrate administration. VTE prophylaxis during and after delivery was successful in all women with CAD. However, one woman in the low-risk group did not receive heparin and developed VTE induced by severe hyperemesis at 9 gestational weeks, before the diagnosis of CAD. Women in the high-risk group received antithrombin concentrate after delivery but had increased D-dimer levels at postpartum. CONCLUSIONS: Our protocol to prevent VTE in pregnant women with CAD is safe and effective.

Hereditary antithrombin deficiency in pregnancy - severe thrombophilic disorder as a danger for mother and foetus

SETTING: In the article, we remember the role of antithrombin (AT) in hemostasis, escalation of AT-potential with heparin and difficulties with monitoring the effectiveness of LMWH therapy (low molecular weight heparin) in patients with AT deficiency. We pay most of our attention to hereditary AT deficiency and its thromboembolic risk in pregnancy. METHODS: In the introduction, the principle of AT function, its two main domains and the regulation of synthesis are cleared. We describe the causal mutations of hereditary AT deficiency in SERPINC1 gen and the relation to a thromboembolic risk. The general recommendations for patients with hereditary AT deficiency and pregnant women are mentioned. As the risk of thromboembolic disease is escalated in pregnancy, the LMWH should always be considered. There has been frequently observed that patients with AT deficiency do not elevate anti-Xa-levels when standard prophylactic LMWH doses are used. This fact well illustrates that heparin without AT may not inhibit the active coagulant factors efficiently enough. Therefore, if a high thromboembolic risk in the patient's anamnesis is present, the LMWH dosing should be escalated. In individual cases, concomitant administration of an antithrombin concentrate to the heparin treatment is recommended at the time of delivery or in the case of deep venous thrombosis. In this article, three cases of unusual pregnancy in patients with different types of AT deficiency are reported. The case reports are summarized from the Department of Hematology at Hospital Kolín, the Centre of Hemostasis and Thrombosis at Institute of Hematology and Blood Transfusion in Prague and from cooperating obstetrical departments in the Czech Republic. RESULTS: We demonstrated the threat of hereditary AT deficiency in three case reports. In one case, the estimated risk of thromboembolism ­ type I of AT-deficiency (quantitative) ­ was in a good correlation with real peripartal complications. In the next two cases with different types of AT deficiency, we showed surprising courses of complicated pregnancies. CONCLUSION: As it has been shown, it is not safe to estimate the risk of thromboembolism on the base of causal mutation for AT deficiency. For present clinical practice, we should still remember AT deficiency as a potentially very dangerous thromboembolic disorder for mother and fetus; thus, excellent cooperation of an obstetrician and a hematologist is necessary.

Antithrombin Deficiency in Trauma and Surgical Critical Care.

Antithrombin deficiency (ATD) was described in 1965 by Olav Egeberg as the first known inherited form of thrombophilia. Today, it is understood that ATDs can be congenital or acquired, leading to qualitative, quantitative, or mixed abnormalities in antithrombin (AT). All ATDs ultimately hinder AT's ability to serve as an endogenous anticoagulant and antiinflammatory agent. As a result, ATD patients possess higher risk for thromboembolism and can develop recurrent venous and arterial thromboses. Because heparin relies on AT to augment its physiologic function, patients with ATD often exhibit profound heparin resistance. Although rare as a genetic disorder, acquired forms of ATD are seen with surprising frequency in critically ill patients. This review discusses ATD in the context of surgical critical care with specific relevance to trauma, thermal burns, cardiothoracic surgery, and sepsis.

Successful treatment of a massive sinus thrombosis in a Chinese woman with antithrombin III deficiency: a case report and review of the literature.

: The incidence of antithrombin III (AT III) deficiency is very rare. The most common complication of AT III deficiency is deep venous thrombosis, which causes a low incidence of intracranial sinus thrombosis. We presented a 31-year-old Chinese woman patient who had a family history of AT III deficiency admitted to our hospital. She had a history of pulmonary embolism. She took rivaroxaban for a long time to prevent thrombosis. After giving birth, she stopped taking the medication for half a year and suffered from drug withdrawal symptoms. Four months after drug withdrawal, she suddenly fell into a coma. After diagnosis, it was found to be caused by a subarachnoid hemorrhage. Finally, she was diagnosed with sagittal and transverse sinus thrombosis. After treatment with mechanical thrombectomy, she fully recovered. In sum, we concluded that mechanical thrombectomy was efficient for AT III deficiency and treating thrombosis.

Novel SERPINC1 missense mutation (Cys462Tyr) causes disruption of the 279Cys-462Cys disulfide bond and leads to type â hereditary antithrombin deficiency.

BACKGROUND: Antithrombin (AT) is the primary physiological anticoagulant of normal hemostasis. Hereditary AT deficiency, an autosomal dominant thrombotic disease caused by mutations in the AT gene (SERPINC1), is associated with venous thromboembolism. OBJECTIVE: We investigated the phenotypes, genotypes, and pathogenesis of hereditary AT deficiency in a 12-year-old boy (proband) who developed a pulmonary embolism and a subsequent deep vein thrombosis. METHODS: The AT activity and AT antigen level of the proband and his family members were measured. Mutation sites in all seven exons of SERPINC1 were identified. Analysis of conserved regions around codon 462 of the SERPINC1 gene and functional predictions were performed using bioinformatics tools. RESULTS: The proband, his father, and his paternal grandmother demonstrated reduced AT activity and antigen levels consistent with Type I AT deficiency. A novel heterozygous missense mutation, c.1385G>A (Cys462Tyr) was identified in all three symptomatic family members. This missense mutation causes disruption of the 279Cys-462Cys disulfide bond and leads to type Ⅰ hereditary AT deficiency. CONCLUSION: A SERPINC1 missense mutation (Cys462Tyr) causing damage to the 279Cys-462Cys disulfide bond of the AT protein appears to be the cause of Type I AT deficiency in this family. These findings indicate one pathological mechanism associated with hereditary AT deficiency.

Severe Antithrombin Deficiency May be Associated With a High Risk of Pathological Progression of DIC With Suppressed Fibrinolysis.

The frequency of severe antithrombin deficiency (SAD) was examined in the hematopoietic disorder-, infectious-, and basic-types of the disseminated intravascular coagulation (DIC). A posthoc analysis of 3008 DIC patients (infectious-type, 1794; hematological disorder-type, 813; and basic-type, 401) from post-marketing surveillance data of thrombomodulin alfa was performed. The clinical features of patients and outcomes were compared between patients with and without SAD, using an antithrombin cutoff value of 50%. Patients with SAD accounted for 40.4% of infectious-type DIC, 8.0% of hematopoietic disorder-type DIC, and 26.7% of basic-type DIC. There was no significant difference in thrombin-antithrombin complex levels between patients with and without SAD. The decreased fibrinogen level and differences in clinical features were significantly greater but the increases in fibrinolytic markers were significantly lower in patients with SAD than in those without. The 28-day survival rate was significantly lower in patients with SAD than in those without. Severe antithrombin deficiency was observed in all types of DIC, including hematopoietic disorders. Both hypofibrinolysis and hypercoagulability in patients with SAD may cause multiple organ failure and poor outcomes.

Congenital antithrombin deficiency in patients with splanchnic vein thrombosis.

BACKGROUND AND AIMS: Splanchnic vein thromboses (SVT) are a rare condition that can be life-threatening. The most severe thrombophilia associated to SVT is antithrombin (AT) deficiency, usually caused by SERPINC1 mutations. Although transitory AT deficiencies and congenital disorders of the N-glycosylation pathways (CDG) have been recently reported as causes of AT deficiency, the current AT clinical screening still only includes anti-FXa activity. This study aims to (a) improve the detection of AT deficiency in SVT and (b) characterize the features of AT deficiency associated with SVT. METHODS: The study was performed in 2 cohorts: (a) 89 SVT patients with different underlying etiologies but in whom AT deficiency had been ruled out by classical diagnostic methods; and (b) 271 unrelated patients with confirmed AT deficiency and venous thrombosis. AT was evaluated by functional (anti-FXa and anti-FIIa) and immunological methods (ELISA, crossed immunoelectrophoresis, western blot), and SERPINC1 sequencing was performed. RESULTS: In 4/89 patients (4.5%) additional alterations in AT were found (two had SERPINC1 mutations, one had a specific variant causing transient AT deficiency and one patient had CDG). In 11 of the 271 patients (4.1%) with AT deficiency and thrombosis, thrombosis was located at the splanchnic venous territory. CONCLUSIONS: Antithrombin deficiency may be underdiagnosed by current clinical screening techniques. Therefore, a comprehensive AT evaluation should be considered in cases of rethrombosis or doubtful interpretation of anti-FXa activity levels. SVT is a relatively common localization of the thrombotic event in patients with congenital AT deficiency.

How I treat patients with hereditary antithrombin deficiency.

Genetic predispositions to venous thromboembolism (VTE) are relatively frequent in the general population and comprise a heterogeneous group of disorders. Whereas the most frequent congenital risk factors for thrombosis only moderately increase the risk, a deficiency in antithrombin (AT), one of the most important natural inhibitors of blood coagulation, carries a higher risk. Congenital AT deficiency is an infrequently encountered genetic risk factor for VTE, and different subtypes vary with regard to their thrombotic risk. Patients with congenital AT deficiency, especially those with quantitative deficiency (type 1), may develop thrombosis early in life and often have a conspicuous family history of first- and second-degree relatives with VTE. Women are particularly affected because of the risk potentiation by combined estrogen/progestogen oral contraceptive use or pregnancy. The lack of controlled trials or even observational studies of large cohorts does not allow therapeutic decisions to be based on scientific evidence. In this review, we will discuss cases with thrombotic manifestations and the tailored management of patients with this congenital thrombosis risk factor.